Abstract

Nitric oxide (NO) generated by nitric-oxide synthase (NOS) is a key regulator of animal physiology. Here we uncover a role for NO in shaping circuit dynamics to orchestrate light-avoidance behaviour. We studied UV/violet light avoidance mediated by brain ciliary photoreceptors (cPRCs) in larval Platynereis dumerilii, a marine annelid. We found NOS expressed in interneurons (INNOS) postsynaptic to cPRCs. Stimulation of cPRCs by violet light leads to cPRC inhibition but concomitant INNOS activation and NO production. NO feeds back to cPRCs and triggers their delayed activation through an unconventional guanylyl cyclase. This results in the activation of projection interneurons and the inhibition of serotonergic ciliomotor neurons. In NOS mutants, NO feedback and projection-neuron activation do not occur and avoidance behaviour is defective. By mathematical modelling, we could recapitulate phototransduction and circuit dynamics in both wild-type and mutant larvae. Our results reveal how NO-mediated retrograde signalling gates a synaptic circuit to initiate light-avoidance behaviour.

Introduction

In nervous systems, synaptic transmission and volume transmission together shape circuit dynamics. While synaptic transmission occurs at specialised contact sites, volume transmission is characterised by the delocalised release of diverse diffusive neuromodulators.

Nitric oxide (NO) is one such modulator with unique physical and signalling properties. This free radical synthesized by nitric oxide synthase (NOS) is short-lived and can diffuse across biological membranes (Cudeiro and Rivadulla, 1999; Thomas, 2015). Canonical NO signalling involves the activation of neuronal NOS following calcium increase, NO production and diffusion, and the NO-dependent activation of soluble guanylate cyclases (sGC) in target cells leading to cGMP production (Bredt et al., 1990; Hölscher, 1997). Given that NOS activation is calcium dependent and NOS shows neuron-type-specific expression (Gibbs and Truman, 1998; Mobley et al., 2022; Wildemann and Bicker, 1999), NO action can lead to the activity-dependent modulation of neural circuits at specific sites (Jacoby et al., 2018; Vielma et al., 2014; Wang et al., 2007) .

NO signalling has been extensively studied in the vertebrate retina where NOS is expressed in amacrine, ganglion as well as other cells (Cudeiro and Rivadulla, 1999; Jacoby et al., 2018; Wang et al., 2007). The actions of NO can be diverse and not always involve the canonical sGC-cGMP pathway (Jacoby et al., 2018; Tooker et al., 2013; Wei et al., 2012). Defective NO signalling in NOS knockouts for example leads to a decreased sensitivity of retinal ganglion cells to light stimulation (Wang et al., 2007). However, due to the complex expression of NOS in vertebrates and the diversity of its functions, it has been challenging to link the neurophysiological effects of NO to signalling mechanisms and behaviour change.

In the whole organism context, NO signalling has often been studied in diverse marine invertebrates, where NO can regulate larval settlement and metamorphosis (Leise et al., 2001; Locascio et al., 2022; Song et al., 2021; Ueda et al., 2016; Zhang et al., 2012). While NOS-expressing neurons potentially responsible for these effects have been reported (Bishop and Brandhorst, 2007; Locascio et al., 2022), it has not been possible to link these NO-dependent effects on behaviour or life-cycle transitions to neuronal activity and function.

Due to these difficulties, we still know little at the whole organism level about how NO production relates to stimulus conditions, how it shapes circuit activity at specific neuron types, and how NO-dependent modulation relates to behaviour.

To investigate NO function in neural circuit dynamics and behaviour, here we study larvae of the marine annelid model Platynereis dumerilii (Ozpolat et al., 2021). Platynereis has emerged as a systems neuroscience model where behaviour and activity imaging can be combined with genetic manipulations and a whole-body synaptic connectome and gene expression atlases are available (Ozpolat et al., 2021; Verasztó et al., 2020; Verasztó et al., 2017; Vergara et al., 2021).

Here we uncovered an essential function for NO signalling in larval UV/violet-light avoidance behaviour. In Platynereis larvae, UV/violet avoidance is mediated by brain ciliary photoreceptor cells (cPRCs) and is characterised by downward swimming (Verasztó et al., 2018). The cPRCs express a ciliary-type opsin, c-opsin1 (Arendt et al., 2004) that forms a UV-absorbing bistable photopigment with an absorption maximum around 384 nm Veedin Rajan et al. (2021). Upon UV/violet exposure, the cPRC show a characteristic biphasic calcium response that is c-opsin1 dependent. UV/violet avoidance is also c-opsin1-dependent and is defective in c-opsin1 mutants (Verasztó et al., 2018). Here we show that Platynereis NOS is expressed in interneurons of the cPRC circuit and is required for UV/violet-avoidance. By combining calcium imaging across the fully-mapped cPRC circuit (Verasztó et al., 2018) with genetic perturbations and mathematical modelling, we describe how NO tunes circuit dynamics through non-synaptic retrograde signalling to cPRCs. This delayed neuroendocrine feedback integrates UV/violet exposure to induce a short-term memory manifested in altered circuit activity and an aversive behavioural response.

Results

Nitric oxide synthase is expressed in interneurons of the UV-avoidance circuit

We identified a single nitric oxide synthase (NOS) gene in the Platynereis dumerilii genome and transcriptome data. Phylogenetic analysis of NOS proteins indicate that Platynereis NOS belongs to an orthology group of metazoan NOS sequences (Figure 1—figure supplement 1). To characterise the expression pattern of NOS we used in situ hybridization chain reaction (HCR) and transient transgenesis. In two- and three-day-old larvae, we detected NOS expression in four cells (two of them weakly expressing) in the apical organ region (Figure 1D and Figure 1—figure supplement 2). NOS was also expressed in the region of the visual eyes (adult eyes) and the pigmented eyespots (Figure 1—figure supplement 2). The four apical organ cells, but not the eyes, were also labelled with a NOS reporter construct driving palmitoylated-tdTomato (Figure 1E). This reporter also revealed the axonal projections of these central NOS-expressing neurons. The position and morphology of the four NOS+ cells allowed us to identify the same four cells as four interneurons (INNOS) in our three-day-old whole-body Platynereis volume EM data (Verasztó et al., 2020; Williams et al., 2017) (Figure 1B,C). In the synaptic connectome, the INNOS cells are postsynaptic to the UV-sensory cPRCs and presynaptic to the INRGW interneurons, which are also cPRC targets (Figure 1C,F). The projections of INNOS cells are segregated into input and output compartments, with cPRCs inputs occurring in the dense neurosecretory plexus. INNOS output synapses form in the more ventral projection region (Figure 1—figure supplement 3). INRGW neurons synapse on the head serotonergic ciliomotor neurons (Ser-h1), which synapse on the prototroch ciliary band and the cholinergic MC ciliomotor neurons (Figure 1C,F) (Verasztó et al., 2017).

**Figure 1. Identification of NOS-expressing interneurons (INNOS) within the cPRC circuit.** **(A)** Scanning electron microscopy image of a three-day-old *Platynereis* larva. **(B, C)** Volume rendering of the neuron types (cPRC, INNOS, INRGW, Ser-h1 and MC) in the cPRC circuit reconstructed from a whole-body transmission electron microscopy volume of a three-day-old larva. Neurite skeletons are shown with cell-body positions represented by spheres. Projections of all neurons in the body are shown in grey to highlight the neuropils. The outline of the yolk is also indicated in grey. In B, nuclei positions of the prototroch head ciliary band are shown as grey spheres. **(D)** Expression of the *NOS* gene detected by in situ HCR (magenta) in a two-day-old larva (anterior view). Antibody staining for acetylated α-tubulin (acTub: green) highlights cPRC cilia and the neuropil. **(E)** Expression of a *NOS* reporter (NOSp::palmi-3xHA: magenta) labelled with an anti-HA antibody in a two-day-old larva (anterior view). Antibody staining for acetylated α-tubulin (acTub: green) highlights cPRC cilia and the neuropil. **(F)** Synaptic wiring diagram of the cPRC circuit. Hexagons represent cell groups, with the number of cells per group shown in square brackets. Arrows represent the summed number of synaptic contacts between cell groups. Arrow thickness is proportional to the number of synapses.

Figure 1. Identification of NOS-expressing interneurons (INNOS) within the cPRC circuit. (A) Scanning electron microscopy image of a three-day-old Platynereis larva. (B, C) Volume rendering of the neuron types (cPRC, INNOS, INRGW, Ser-h1 and MC) in the cPRC circuit reconstructed from a whole-body transmission electron microscopy volume of a three-day-old larva. Neurite skeletons are shown with cell-body positions represented by spheres. Projections of all neurons in the body are shown in grey to highlight the neuropils. The outline of the yolk is also indicated in grey. In B, nuclei positions of the prototroch head ciliary band are shown as grey spheres. (D) Expression of the NOS gene detected by in situ HCR (magenta) in a two-day-old larva (anterior view). Antibody staining for acetylated α-tubulin (acTub: green) highlights cPRC cilia and the neuropil. (E) Expression of a NOS reporter (NOSp::palmi-3xHA: magenta) labelled with an anti-HA antibody in a two-day-old larva (anterior view). Antibody staining for acetylated α-tubulin (acTub: green) highlights cPRC cilia and the neuropil. (F) Synaptic wiring diagram of the cPRC circuit. Hexagons represent cell groups, with the number of cells per group shown in square brackets. Arrows represent the summed number of synaptic contacts between cell groups. Arrow thickness is proportional to the number of synapses.

Nitric oxide is produced during UV/violet stimulation of the cPRCs

The expression of NOS in the INNOS interneurons in the cPRC circuit suggests that NO signalling may be involved in UV/violet-avoidance. To test this, first we asked whether NO is produced during UV/violet stimulation of the larvae. We injected the fluorescent NO-reporter DAF-FM into zygotes and imaged two-day-old larvae while exposing the cPRC region to 405 nm violet light. Following light stimulation in the region of the cPRCs but not a control area, we detected an increase in DAF-FM fluorescence in the anterior neurosecretory neuropil, the region of INNOS projections (Figure 2).

**Figure 2. NO produced by UV/violet stimulation to cPRCs.** **(A)** DAF-FM fluorescence in the region of the neurosecretory neuropil. The white line indicates the outline of the larva. The dashed line corresponds to the area where fluorescence was quantified. **(B)** Changes in DAF-FM fluorescence before and during 405 nm light stimulation. **(C)** Changes in DAF-FM fluorescence over time during 405 nm stimulation of the cPRCs (green) or a control area (ctr: gray). The purple box indicate the duration of 405 nm stimulation. Individual traces normalized (ΔF/F0) are shown as thin lines. Thick lines show the mean value with 0.95 confidence intervals. N = 6 for cPRC stimulation.

Figure 2. NO produced by UV/violet stimulation to cPRCs. (A) DAF-FM fluorescence in the region of the neurosecretory neuropil. The white line indicates the outline of the larva. The dashed line corresponds to the area where fluorescence was quantified. (B) Changes in DAF-FM fluorescence before and during 405 nm light stimulation. (C) Changes in DAF-FM fluorescence over time during 405 nm stimulation of the cPRCs (green) or a control area (ctr: gray). The purple box indicate the duration of 405 nm stimulation. Individual traces normalized (ΔF/F0) are shown as thin lines. Thick lines show the mean value with 0.95 confidence intervals. N = 6 for cPRC stimulation.

Nitric oxide signalling mediates UV-avoidance behaviour

Next, we wanted to directly test whether NO signalling is involved in UV/violet avoidance. To achieve this, we generated two Platynereis NOS knockout lines with the CRISPR/Cas9 method. We recovered two deletions (NOSΔ11/Δ11 and Δ23/Δ23), both leading to frame-shift and an early stop codon and thus likely representing null alleles (Figure 3—figure supplement 1A). We could establish a homozygous line for both mutations indicating that NOS is not an essential gene. To quantify UV avoidance, we recorded the trajectories of freely swimming wild type and mutant larvae in vertical columns, illuminated laterally from two opposite sides with 395 nm UV light (Figure 3A and Figure 3—figure supplement 1B). As previously shown, wild-type larvae swim downward following non-directional UV/violet light stimulation (Verasztó et al., 2018). In contrast, both two- and three-day-old homozygous NOS-mutant larvae showed a strongly diminished UV-avoidance response (Figure 3A, B and Figure 3—figure supplement 1B,C). This phenotype is similar to the defective UV-avoidance of c-opsin1 mutant larvae and reveals a requirement for NOS in UV-avoidance behaviour (Verasztó et al., 2018). Wild type but not mutant larvae also showed an increase in swimming speed under UV light that may be due to downward swimming trajectories (swimming with gravity) (Figure 3B and Figure 3—figure supplement 1C). We also tested directional phototaxis, by exposing larvae to 480 nm directional and collimated light from the top of the column. Three-day-old but not two-day-old NOS-mutant larvae also showed reduced phototactic behaviour, suggesting a function for NOS in the visual eyes that mediate three-day-old phototaxis (Randel et al., 2014) (Figure 3D and Figure 3—figure supplement 1G). To distinguish between an acute or developmental function of NOS in light responses, we next tested larvae exposed to the NOS inhibitor L-NAME. Larvae incubated for 5 min in 0.1 mM or 1 mM L-NAME showed a dose-dependent inhibition of UV avoidance. In contrast, phototaxis was not effected (Figure 3C, E). Overall, our results indicate an acute requirement for NOS signalling in UV-avoidance and a possible indirect, developmental role in the visual system, reminiscent of the developmental role for NO signalling in the Drosophila eye (Gibbs and Truman, 1998).

**Figure 3. Larvae with inhibited NOS have a delayed response to UV-avoidance.**  **(B)** Overlaid trajectories for WT (n=32) and NOS mutant (NOSΔ11/Δ11, n=26 and NOSΔ23/Δ23, n=47) at three-day-old larvae. 0 sec as the starting point. After 10 sec, UV (395 nm) stimulation from the side. **(C)** The temporal changes in the vertical position of the WT and mutant larvae before (dark) and after UV stimulation (side 395 nm) are shown. The starting points of each larval trajectory are set to 0. **(D)** Vertical swimming in wild-type (WT) and mutant (NOSΔ11 and NOSΔ23) larvae at three-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins. **(E)** Vertical swimming in larvae treated with NOS inhibitors, L-NAME at three-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins.

Figure 3. Larvae with inhibited NOS have a delayed response to UV-avoidance. (B) Overlaid trajectories for WT (n=32) and NOS mutant (NOSΔ11/Δ11, n=26 and NOSΔ23/Δ23, n=47) at three-day-old larvae. 0 sec as the starting point. After 10 sec, UV (395 nm) stimulation from the side. (C) The temporal changes in the vertical position of the WT and mutant larvae before (dark) and after UV stimulation (side 395 nm) are shown. The starting points of each larval trajectory are set to 0. (D) Vertical swimming in wild-type (WT) and mutant (NOSΔ11 and NOSΔ23) larvae at three-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins. (E) Vertical swimming in larvae treated with NOS inhibitors, L-NAME at three-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins.

NO feedback tunes cPRC responses to UV/violet stimulation

To investigate how NO signalling alters the dynamics of the cPRC circuit, we carried out calcium imaging experiments. We ubiquitously expressed the calcium sensor GCaMP6s in larvae and imaged calcium signals during 405 nm stimulation of the cPRCs. As we have shown previously, a 20-sec local stimulation of cPRC cilia lead to a transient increase in cPRC calcium levels, followed by a transient decrease (Verasztó et al., 2018). After ~20-sec, calcium levels in cPRCs were raising again, reaching higher levels than at the start of the stimulus – a response that may involve depolarisation (Figure 4A, B). This activation phase occurs after the 20 sec stimulation period and is likely due to a delayed neuroendocrine feedback (Verasztó et al., 2018). To determine whether NO mediates such a feedback, we repeated the experiment in NOS-mutant larvae. While we detected the initial activation phase followed by inhibition, in NOS-mutants this was not followed by delayed activation and calcium levels dropped to a low steady-state level (Figure 4A, B). We thus identified a requirement for NO signalling in the late-phase activation of cPRCs.

Two unconventional guanylyl cyclases are expressed in the cPRCs

Next, we aimed to identify the NO-receptor in the cPRCs. NO generally acts via soluble guanylate cyclases (sGC), belonging to the guanylate cyclase family with a CYC domain (PFAM domain: PF00211). NO binding to the heme group of sGC leads to increased cyclic guanosine monophosphate (cGMP) production. Analysis of sGCs in Platynereis indicated that these genes are not expressed in any of the cells of the cPRC circuit (Verasztó et al., 2017). Recently, Moroz and coworkers reported an atypical but widely conserved family of guanylyl cyclases with a NIT (nitrite/nitrate sensing) domain (PF08376) (NIT-GC) as potential mediators of NO signalling (Moroz et al., 2020). To search for NIT-GCs in Platynereis, we searched transcriptome resources and retrieved 15 potential NIT-GC homologs (Figure 4—figure supplement 1 and 2). To analyse the relationship of these sequences to metazoan NIT-GCs, we retrieved protein sequences with a CYC domain from the transcriptome and genome databases of 45 metazoan species and 2 choanoflagellate species. We carried out cluster analysis and did phylogenetic reconstruction on a group of membrane-bound guanylyl cyclases with sGCs as an outgroup. In agreement with Moroz et al. (Moroz et al., 2020), we found a group of GCs with NIT domains with representatives in placozoans, cnidarians, some ecdysozoans, echinoderms, and lophotrochozoans. The 15 Platynereis sequences were parts of several major and ancient clades of the tree (Figure 4—figure supplement 1 and 2). To characterise the expression of NIT-GCs, we used previously published spatially mapped single-cell transcriptome data (Achim et al., 2015; Williams et al., 2017). Among the 15 NIT-GCs, two showed high and specific expression in the cPRCs and one was expressed in the INNOS cells (Figure 4—figure supplement 2). In the single-cell data, we could identify the cPRCs by the specific expression of c-opsin1 and a pedal-peptide2 neuropeptide precursor (MLD proneuropeptide) (Arendt et al., 2004; Williams et al., 2017), which have previously been described as cPRC markers (Figure 4—figure supplement 3A). The INNOS cells were identified by NOS expression and spatial mapping in the brain (Achim et al., 2015). We decided to focus on two NIT-GCs expressed in the cPRCs and with a full-length sequence, NIT-GC1 and NIT-GC2. To confirm the single-cell data, we first carried out in situ HCR with probes for NIT-GC1 and NIT-GC2 mRNA. Both genes were specifically expression in the four cPRCs, as confirmed by co-labeling with an acetylated α-tubulin antibody and with an HCR probe against pedal peptide 2/MLD proneuropeptide (Figure 4C ,D and Figure 4—figure supplement 3A-C). To analyse the subcellular localisation of NIT-GC1 and NIT-GC2 at the protein level, we raised and affinity-purified polyclonal antibodies against a specific peptide sequence from both proteins. In immunostainings, we found that NIT-GC1 was localise to the region corresponding to the axonal projections of the cPRCs in the anterior nerve plexus (Figure 4E). Co-immunostaining with the rabbit NIT-GC1 antibody and a custom rat antibody raised against a fragment of Platynereis NOS, revealed that both proteins were localised in close proximity in the neurosecretory plexus (Figure 4—figure supplement 3D). In contrast, NIT-GC2 specifically labelled the large sensory ciliary region of the cPRCs (Figure 4F). These different subcellular localisations suggest that the two NIT-GCs are involved in different intracellular signalling processes in the ciliary and axonal regions of the cPRCs.

NIT-GC1 produces cGMP in an NO-dependent manner

To further characterise these atypical guanylyl cyclases, we focused on NIT-GC1 and carried out in vitro experiments. In bacteria, NIT domains are thought to regulate cellular functions in response to intra- or extracellular nitrate and nitrite. NIT-GC1 has a NIT domain and a highly conserved cyclase domain that is expected to catalyse cGMP synthesis (Figure 4G). The NIT domain may render NIT-GC1 dependent on NO signals. To test this, we co-expressed the synthetic cGMP indicator Green cGull (Matsuda et al., 2016) and NIT-GC1 in cultured cells COS-7 (monkey kidney). For balanced expression, we used a single plasmid with the two open-reading frames separated by the 2A self-cleaving peptide (Figure 4H). Application of the NO donor SNAP lead to increased cGMP levels, an effect we did not observe when cells were exposed to DMSO or when Green cGull was expressed alone (Figure 4I-K). To test whether cGMP production is dependent on the NIT domain, we also tested a deletion construct of NIT-GC1 lacking the NIT domain (Figure 4G). Cells expressing this construct and Green cGull did not show increased cGMP levels when exposed to SNAP (Figure 4L). These results indicate that NIT-GC1 is able to catalyse cGMP production in an NO-dependent manner and this function requires the NIT domain. These results establish NIT-GC1 as a biochemical NO sensor.

NIT-GC1 is required for NO-mediated feedback to cPRCs during the UV response

To test the in vivo function of NIT-GC1 and NIT-GC2 in cPRC responses, we combined calcium imaging with morpholino-mediated knockdowns. We used two translation-blocking morpholinos for each NIT-GC gene and tested knockdown efficiency by immunostaining injected animals with the NIT-GC1 and NIT-GC2 antibodies (Figure 4—figure supplement 3E,F). For both genes, the morpholinos led to a strong reduction in the respective antibody signal, confirming efficient knockdown and antibody specificity.

In NIT-GC1 morphant larvae, the delayed activation of cPRCs following 405 nm stimulation did not occur (Figure 4M). This phenotype is similar to the phenotype of NOS mutants suggesting that NIT-GC1 acts as the NO sensor in cPRCs to drive their delayed activation. This could occur via increased cGMP production and the opening of a cyclic-nucleotide-gated (CNG) channel specific to cPRCs(Tosches et al., 2014). NIT-GC2 morphant larvae, in contrast, showed a step-up increase in calcium following light stimulation (Figure 4N). The calcium signal decayed during stimulation and was off after light off. These data support an essential role for ciliary-localised NIT-GC2 in suppressing cPRC calcium following its transient rise at stimulus onset. Overall, these knockdown experiments revealed different signalling mechanisms for the two NIT-GCs that may be due to their different subcellular localisations.

**Figure 4. cPRC-specific expression of NIT-GC1 localises in close proximity to NOS in the ANS region.** **(A, B)** Changes over time in GCaMP6s intensities in cPRC when stimulated with UV in WT (dark yellow) and NOS mutant (E: NOSΔ11/Δ11, F: NOSΔ23/Δ23) (light pink) larvae. **(C, D)** Expression analysis of the NIT-GC1 (C) and NIT-GC2 (D) gene (magenta) using in situ HCR. Co-staining image using acetylated α-tubulin antibody (ac α-tub: green). **(E, F)** Localisation analysis using NIT-GC1 (E) and NIT-GC2 (F) antibodies. Green shows co-staining with acetylated α-tubulin antibody (ac α-tub). **(G)** The domain structure of NIT-GC1. Below shows the mutant NIT-GC1 (NIT-GC1ΔNIT) with deletion of the NIT domain. Grey squares indicate the transmembrane region (TM). **(H)** A schematic of the NIT-GC1 assay; COS7 cells were used to express NIT-GC1 and the cGMP indicator Green cGull, and the NO donor SNAP and DMSO as control. Green cGull shows cGMP-dependent green fluorescence. **(I-L)** The intensity changes in cGMP fluorescence over time for the four conditions are shown. Gray traces show the optical responses to individual intensities (n > 6). The individual intensities are normalized (ΔF/F0). The dark line shows the mean value and the band the standard error range of the mean. The respective solution was acted on 2 min after the start of imaging (grey bars). **(M, N)** Changes over time in GCaMP6s intensities in cPRC when stimulated with UV in NIT-GC1 (G: NIT1) and NIT-GC2 (H: NIT2) knockdown by morpholino (MO1 and 2) larvae.

Figure 4. cPRC-specific expression of NIT-GC1 localises in close proximity to NOS in the ANS region. (A, B) Changes over time in GCaMP6s intensities in cPRC when stimulated with UV in WT (dark yellow) and NOS mutant (E: NOSΔ11/Δ11, F: NOSΔ23/Δ23) (light pink) larvae. (C, D) Expression analysis of the NIT-GC1 (C) and NIT-GC2 (D) gene (magenta) using in situ HCR. Co-staining image using acetylated α-tubulin antibody (ac α-tub: green). (E, F) Localisation analysis using NIT-GC1 (E) and NIT-GC2 (F) antibodies. Green shows co-staining with acetylated α-tubulin antibody (ac α-tub). (G) The domain structure of NIT-GC1. Below shows the mutant NIT-GC1 (NIT-GC1ΔNIT) with deletion of the NIT domain. Grey squares indicate the transmembrane region (TM). (H) A schematic of the NIT-GC1 assay; COS7 cells were used to express NIT-GC1 and the cGMP indicator Green cGull, and the NO donor SNAP and DMSO as control. Green cGull shows cGMP-dependent green fluorescence. (I-L) The intensity changes in cGMP fluorescence over time for the four conditions are shown. Gray traces show the optical responses to individual intensities (n > 6). The individual intensities are normalized (ΔF/F0). The dark line shows the mean value and the band the standard error range of the mean. The respective solution was acted on 2 min after the start of imaging (grey bars). (M, N) Changes over time in GCaMP6s intensities in cPRC when stimulated with UV in NIT-GC1 (G: NIT1) and NIT-GC2 (H: NIT2) knockdown by morpholino (MO1 and 2) larvae.

NO signalling shapes the dynamics of the cPRC circuit

To investigate how NO and NIT-GC signalling influence the dynamics of the cPRC circuit, we imaged calcium signals from postsynaptic neurons in wild type, mutant and morphant larvae. We were able to image the activity of all neurons in the cPRC circuit (INNOS, INRGW, Ser-h1 and MC). The MC cell was identified based on its position and intrinsic activity. To unambiguously identify all other cells from which we recorded calcium signals, we developed an on-slide immunostaining method (Figure 5—figure supplement 1A). We used the cell-specific antibody markers against RYamide (INNOS) (Figure 5—figure supplement 1B-D), RGWamide (INRGW) and serotonin (Ser-h1) (Conzelmann et al., 2011) to immunostain agar-embedded larvae following calcium imaging. Based on the position of the nuclei, we could correlate live and fixed samples at a single-cell precision (Figure 5A,B). Due to the stereotypy of the larvae, we could also identify neurons based on their position and activity in activity-correlation maps (Figure 5C).

We first quantified the responses of the INNOS and INRGW interneurons during 405 nm stimulation of the cPRCs. In both wild type and NOS-mutant larvae, INNOS cells showed an increase in calcium during stimulation (Figure 5D). This response was suppressed in NIT-GC2 morphant larvae (Figure 5E) revealing an essential role for NIT-GC2-mediated cPRC suppression in INNOS activation. In contrast, INRGW cells were initially inhibited, followed by a delayed activation paralleling the second activation phase of cPRCs. This late INRGW response was lacking in NOS-mutants (Figure 5F,G). In NIT-GC2 morphants, INRGW cells showed a transient increase in calcium that decayed after light off and a delayed activation was not present. Next, we imaged calcium signals from Ser-h1 and MC neurons in wild type and NOS mutant larvae. Ser-h1 cells showed an activation profile that correlated with cPRC activity, including a reduction in calcium during stimulation followed by rebound, a response that was defective in NOS mutants. MC cells showed sustained activation, including a late-phase that was lacking in NOS mutants (Figure 5H,I). These data suggest that during 405 stimulation the Ser-h1 cells are inhibited and MC cells are activated, and this regulation is NO-dependent. This pattern is expected to inhibit ciliary activity in the prototroch but not in the other ciliary bands, triggering NO-dependent downward swimming.

**Figure 5. NO produced by UV stimulation to cPRCs induces a depolarising response in cPRC via NIT-GC1.** **(A, B)** Each left figure shows a calcium imaging using GCaMP6s. The respective right figures show immunostaining images of the same positions in the respective left figures, (A) shows RYamide antibodies, (B) shows RGWamide and serotonin (5-HT) antibodies in red and DAPI in cyan. Asterisks indicate the nuclei of the cPRC, respectively, and the nuclei of the cells that were identified from the arrangement of the surrounding cells are indicated by numbers. From the position of the cells, the calcium imaging data identify INNOS in (A) and INRGW and Ser-h1 in (B), respectively. **(C)** Correlation (Pearson's r) map of neuronal activity of the INNOS, INRGW, Ser-h1 and MC neurons. **(D)** Changes over time in GCaMP6s intensities in INNOS when cPRC is stimulated with UV in WT (dark purple) and NOSΔ11/Δ11 mutant (light purple) larvae. **(E)** Changes over time in GCaMP6s intensities in INNOS when cPRC is stimulated with UV in NIT-GC2 morphants (MO1 and MO2: pink and light pink) larvae. **(F)** Changes over time in GCaMP6s intensities in INRGW when cPRC is stimulated with UV in WT (dark blue) and NOSΔ23/Δ23 mutant (light blue) larvae. **(G)** Changes over time in GCaMP6s intensities in INRGW when cPRC is stimulated with UV in NIT-GC2 morphants (MO1 and MO2: blue and light blue). **(H, I)** Changes over time in GCaMP6s intensities in Ser-h1 and MC when cPRC is stimulated with UV in WT (Ser-h1 and MC: dark red and brown) and NOSΔ11/Δ11 mutant (Ser-h1 and MC: light red and brown) larvae.

Figure 5. NO produced by UV stimulation to cPRCs induces a depolarising response in cPRC via NIT-GC1. (A, B) Each left figure shows a calcium imaging using GCaMP6s. The respective right figures show immunostaining images of the same positions in the respective left figures, (A) shows RYamide antibodies, (B) shows RGWamide and serotonin (5-HT) antibodies in red and DAPI in cyan. Asterisks indicate the nuclei of the cPRC, respectively, and the nuclei of the cells that were identified from the arrangement of the surrounding cells are indicated by numbers. From the position of the cells, the calcium imaging data identify INNOS in (A) and INRGW and Ser-h1 in (B), respectively. (C) Correlation (Pearson’s r) map of neuronal activity of the INNOS, INRGW, Ser-h1 and MC neurons. (D) Changes over time in GCaMP6s intensities in INNOS when cPRC is stimulated with UV in WT (dark purple) and NOSΔ11/Δ11 mutant (light purple) larvae. (E) Changes over time in GCaMP6s intensities in INNOS when cPRC is stimulated with UV in NIT-GC2 morphants (MO1 and MO2: pink and light pink) larvae. (F) Changes over time in GCaMP6s intensities in INRGW when cPRC is stimulated with UV in WT (dark blue) and NOSΔ23/Δ23 mutant (light blue) larvae. (G) Changes over time in GCaMP6s intensities in INRGW when cPRC is stimulated with UV in NIT-GC2 morphants (MO1 and MO2: blue and light blue). (H, I) Changes over time in GCaMP6s intensities in Ser-h1 and MC when cPRC is stimulated with UV in WT (Ser-h1 and MC: dark red and brown) and NOSΔ11/Δ11 mutant (Ser-h1 and MC: light red and brown) larvae.

Mathematical modelling of cPRC-circuit dynamics

We analysed the neurotransmitter-related genes expressed in the respective cells identified from the single-cell transcriptome data of Achim et al. to understand the neurotransmission mechanisms in cPRC, INNOS and INRGWa (Achim et al., 2015; Williams et al., 2017). Interestingly, in cPRC, whereas cholinergic neurons has previously been implicated in neurotransmission (Randel et al., 2014), we found transporters and synthetic enzymes involved in glutaminergic, glycinergic, GABAergic and adrenergic innervation, respectively (Figure 6A). Gene expression has been observed by Randel et al. in these genes, suggesting that they may be expressed in cPRC (Randel et al., 2014). Their receptors were also found for each of the expressed genes within INNOS and INRGWa (Figure 6A). Based on these expression patterns and results, a model of transduction across the cPRC pathway focusing on Ca2+, cGMP and NO dynamics is proposed (Figure 6B). The c-opsin1, which is UV-sensitive, activates G proteins (Gi/Go) and decreases cGMP CNGAα, which is already known to be strongly expressed in cPRC as one of the targets highly dependent on cGMP changes, may regulate the influx of ions into the cell (Arendt et al., 2004; Tsukamoto et al., 2017; Veedin Rajan et al., 2021). The Gβγ released by Gi/o activation also induces K+ efflux (hyperpolarisation) via GIRK channels and closes the voltage-gated Ca2+ channels, thereby reducing intracellular calcium levels(Tsukamoto and Kubo, 2023). It is also thought that increased calcium levels in INNOS signalled from cPRC may activate NOS and generate nitric oxide; INNOS has glycinergic and glutamatergic potential and may act as an inhibitory signal regulator for INRGWa. INRGWa, and may function as an inhibitory signal modulator for INRGWa.

We used this model and calcium imaging data to develop a mathematical model.

**Figure 6. Signalling mechanisms and mathematical modelling between cPRC, INNOS and INRGWa.** **(A)** Dot plot of genes (columns) expressed in three types of cells (rows) in the cPRC circuit using single cell RNA-Seq. The size of the dots is expressed in proportion to the percentage of cells expressing that gene relative to all cells. The colours represent the normal logarithm of the number of transcripts in the cells expressing the gene. **(B)** Schematic diagram of the signalling pathway of the cPRC circuit, focusing on the NO feedback. **(C)** Diagram for **(D)**

Figure 6. Signalling mechanisms and mathematical modelling between cPRC, INNOS and INRGWa. (A) Dot plot of genes (columns) expressed in three types of cells (rows) in the cPRC circuit using single cell RNA-Seq. The size of the dots is expressed in proportion to the percentage of cells expressing that gene relative to all cells. The colours represent the normal logarithm of the number of transcripts in the cells expressing the gene. (B) Schematic diagram of the signalling pathway of the cPRC circuit, focusing on the NO feedback. (C) Diagram for (D)

Discussion

Our work revealed an essential role for NO-mediated signalling in driving UV/violet avoidance behaviour. NO, produced by postsynaptic interneurons, feeds back to their presynaptic photoreceptor partners leading to their delayed activation. This late-phase activation of cPRCs drives circuit output through projection interneurons and ciliomotor neurons. In the cPRC circuit, synaptic connectivity alone is not sufficient to drive circuit dynamics and behavioural change. We identified cPRC-expressed NIT-GC1 as a new type of NO sensor. NIT-GC1 is localised to the axonal projections of the cPRCs in the anterior neurosecretory plexus of the brain. Here, cPRC axons intermingle and synapse on INNOS neurites that contain NOS. NO-mediated feedback signalling thus likely occurs in the neurosecretory plexus where NOS- and NIT-GC1-containing projections are in close proximity and where we could detect NO production following UV stimulation. We showed that NIT-GC1 can produce cGMP in a NO-dependent manner. In cPRCs, increased cGMP levels could open CNGAα, a cyclic nucleotide-gated channels specifically expressed in cPRC (Tosches et al., 2014), leading to cPRC delayed depolarisation, even after UV off. Also our mathematical model…

Functional diversity of NIT-GCs

NO is a free radical with a half-life of 5 msec in vivo and a signalling range limited to a few tens of nanometers. In neuronal signalling, NOS and sGC have been found to localise at close proximity at synapses [Burette et al. (2002)](Garthwaite, 2015). We identified 12 sGCs in Platynereis, but none of these is expressed in the cPRC. Instead, we identified an unconventional NIT-domain containing GC, NIT-GC1 as the mediator of NO retrograde signalling. The NIT domain was first identified in bacteria and animal NIT-GCs have only been recently reported (Moroz et al., 2020; Shu et al., 2003). Bacterial NIT domains regulate cellular functions in response to changes in extracellular and intracellular nitrate and/or nitrite concentrations (Camargo et al., 2007). NO is readily converted to nitrate and nitrite (Garthwaite, 2015; Möller et al., 2019; Santos et al., 2011) and these molecules accumulate in placozoans and cnidarians in cells and tissues with high NOS activity (Moroz et al., 2020, 2004). It is possible that the NIT domains in NIT-GCs may also sense nitrate and nitrite, as in bacteria. Furthermore, if they show different sensitivities to NO, nitrite and nitrate, it is possible that differences in their half-lives could give rise to a range of activation timings (Lundberg et al., 2011). We have found 15 NIT-GCs in Platynereis, suggesting a wide range of functions. In addition, NIT-GC1 and NIT-GC2 showed very different subcellular localisation and functions. It is not clear whether the functional differences are due to the different localisation or also to differences in biochemical function. Overall, the diversification and spatially different localisation patterns of NIT-GCs may increase their signalling repertoire. Our data revealed key roles for two Platynereis NIT-GCs in phototraonsduction and NO-mediated neuromodulation suggesting that these molecules contribute to the diversity of neuronal signalling. Sponges and ctenophores, where NO signalling is present, lack NIT-GCs. In placozoans as many as 12 have been found, and cnidarians also contain a large diversity.

Nitric oxide feedback modulation of UV-avoidance behaviour

Why does a seemingly roundabout feedback pathway exist? The activity of synaptic circuits is richly modulated monoamines, neuropeptides and gaseous molecules. The gaseous second messenger nitric oxide (NO) is known to activate a post- to presynaptic retrograde signalling cascade involving cyclic guanosine monophosphate (cGMP) production. It has been reported that NO produced in one of the mammalian retinal cells modulates cGMP-mediated neurotransmission by activating the presynaptic nerve sGC (a general target of NO) through retrograde signalling (Vielma et al., 2014; Wei et al., 2012). Retrograde signalling of NO is also known to be one of the molecules that regulate memory formation. In Drosophila, NOS of PPL1-γ1pedc shortens memory retention while promoting fast memory updating in response to new experiences, indicating that NO regulates forgetting (Aso et al., 2019). Because NO has a short half-life and may be a suitable second messenger for encoding working memories whose duration must be limited. R-neuron inputs to the ellipsoid in Drosophila also represent visual object orientation for tens of seconds after the disappearance of an object, suggesting that they are involved in short-term visual memory dependent on nitric oxide signalling (Kuntz et al., 2017). In this study, our mathematical modelling results focused on the time of UV stimulation and showed that the late activity comes more delayed during short UV and sooner during long UV. This suggests that animals may have a UV length-dependent short-term memory system that regulates cPRC activation, and that there may be mechanisms by which UV stimulation is enhanced and maintained such that NO feedback maintains neural activation even with slight UV. It is possible that these mechanisms may have been early signalling pathways controlling stimulus changes across space and time in animals’ short-term memory. In planarian UV avoidance behaviour, different time and length scales of neuropeptide and small molecule transmission were reported to generate incoherent patterns of neural activity that competitively control behaviour and memory (Bray et al., 2023). Short-term memory is essential for locating less exposed areas to minimise UV-induced damage in animals.

The mystery of why IN-RGW activation causes downward swimming

One type of interneuron that strongly synapses with the cPRC is INRGWa, which synapses directly onto ciliary motoneurons and is therefore considered to be a very important neuron in larval behavioural control (Verasztó et al., 2018; Williams et al., 2017). Our results suggest that the depolarising response of the cPRC by NO feedback induces INRGW activation. Our experiments have shown that exposure of larvae to RGWamide results in simultaneous downward swimming and that activation of INRGW is sufficient to trigger UV-avoidance behaviour (unpublished data). However, whole-cell tracking by connectome has not revealed any equilibrium organ that recognises the direction of gravity, and it remains to be investigated how activation of INRGWs causes animals to recognise ‘down’, e.g. in RGWamide-deficient larvae. It is known that complex integrative networks of neurons are involved in UV avoidance behaviour in planaria (Shettigar et al., 2021) and Drosophila (Imambocus et al., 2022). It has been reported that the sensory neurons required for UV avoidance behaviour in Drosophila converge and arrest neuromodulatory hub neurons, and that compartmentalised circuit organisation and neuropeptide release from the regulatory hubs act as central circuit elements controlling escape responses. RGW interneurons have been suggested to be important for relaying peptidergic signals due to the distinct anatomy and connectivity of projection neurons in peptidergic networks and their high authority values, and central with many neuronal inputs and outputs network components may function as regulatory hubs that gate the activation of specific networks (Williams et al., 2017). The finding of sGCs in INRGWs from the present single-cell analysis also suggests that they may be regulated by NO. The specific demarcation of sensory input and output through the use of neurotransmitters, neuropeptides and even gaseous NO may further increase the efficiency of network computation in hub neurons and may lead to a more complex mechanism of ‘down’ recognition.

Key resources table

Reagent type (species) Designation Source or reference Identifiers Additional information
Strain (Platynereis dumerilii) NOSΔ11/Δ11 knockout  This paper NA  Knockout generated by CRISPR/Cas-9-induced gene editing
Strain (Platynereis dumerilii) NOSΔ23/Δ23 knockout  This paper NA  Knockout generated by CRISPR/Cas-9-induced gene editing
Strain (Platynereis dumerilii) NOSΔ11/Δ23 knockout  This paper NA  Knockout generated by CRISPR/Cas-9-induced gene editing
Cell line (Cercopithecus aethiops) COS-7 cell NA RRID:CVCL_0224 Angio-proteomie (CAT no. cAP-0203)??
Biological sample (Platynereis dumerilii) Wild type Tübingen strain Other NCBITaxon:6359 Jékely lab strain (Tübingen, Exeter)
Gene (Platynereis dumerilii) NOS This paper GenBank_Acc#: NA
Gene (Platynereis dumerilii) NIT-GC1 This paper GenBank_Acc#: NA
Gene (Platynereis dumerilii) NIT-GC2 This paper GenBank_Acc#: NA
NOS: Nitric_Oxide_Synthase To amplify Promoter & Regulatory region Fwd NOSProm2ndF0.6BamHI AGGGATCCCCCAATGCTTTAGCAGTCAGAGGAG
NOS: Nitric_Oxide_Synthase To amplify Promoter & Regulatory region Rev GeR1ASCI AAGGCGCGCCCCACCACCACCTTTGATATCCATGATGCTCACTTCGC
NOS: Nitric_Oxide_Synthase Mutation Check on Exon3 Fwd Exon3 Sequence F-27bp GGTTCATTGGTTTCGATAACATTGCGG
NOS: Nitric_Oxide_Synthase Mutation Check on Exon3 Rev Exon3 Sequence R-27bp CAGAGTCGATCAGTCTGCATATCTCCA
NOS: Nitric_Oxide_Synthase Sequencing primer for Exon3 mutation check PCR product Fwd Exon3 Sequence F-2 GGTGCTCTCCCGGGTACACAA
RNA sgRNA NA NA 5’-TAGGGCAATACTGGCTCCACTC-3’
RNA sgRNA NA NA 5’-AAACGAGTGGAGCCAGTATTGC-3’
RNA pUC57-T7-RPP2-hSpCas9- HA-2XNLS-GFP NA plasmid Bezares-Calderón et al., 2018
Antibody Monoclonal Anti-Tubulin, Acetylated antibody Sigma-Aldrich Cat#:T6793, RRID:AB_477585 NA
Antibody HA-Tag (C29F4), Rabbit mAb Cell Signaling Technology Cat#:3724P NA
NIT-GC1 polychronal antibodies CYWLLGRKERRPKRRL-amide This paper rabbit Altabioscience
NIT-GC2 polychronal antibodies CTEGSTKEGKKEGQ-amide This paper rabbit Altabioscience
NOS polychronal antibodies CKPSYELQDPWKTYIWRKD-amide This paper Rat Altabioscience
Antibody RYamide neuropeptide antibodies CRY-amide rabbit Conzelmann and Jékely, 2012
Antibody RGWamide neuropeptide antibodies CGW-amide rabbit Conzelmann and Jékely, 2012
Antibody F(ab’)2-Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 546 Invitrogen Catalog # A-11071 NA
Antibody Goat anti-Rat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ Plus 594 Invitrogen Catalog # A48264 NA
Antibody F(ab’)2-Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 Invitrogen Catalog # A-21237 NA
Recombinant DNA reagent NIT-GC1 full comp411593_c0_seq1_309_F NA GGTTGAATAATGACAAGCAAGGAGA
Recombinant DNA reagent NIT-GC1 full comp411593_c0_seq1_2717_R NA GTGCTATCATTTCCAGGTAAATACCC
Recombinant DNA reagent NIT-GC2 full Contig2280_66_F NA AATATCTAGCGAAGGAGAACACCTCTCTTC
Recombinant DNA reagent NIT-GC2 full Contig2280_2763_R NA ATGGCCAGTAATAAACCATCAGTGGTTC
Recombinant DNA reagent pcDNA3.1(+) vector Invitrogen Catalog Number: V79020 NA
Recombinant DNA reagent Inverse PCR for the insert region of pcDNA3.1(+) pcDNA3.1(+)_inv_NheI_fwd NA CGTTTAAACTTAAGCTTGGTACCGAG
Recombinant DNA reagent Inverse PCR for the insert region of pcDNA3.1(+) pcDNA3.1(+)_inv_NheI_rev NA CCAGCTTGGGTCTCCCTATAGT
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull NITGC-T2A-fwd NA TATAGGGAGACCCAAGCTGGGCCACCATGACCCAGATG
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull NITGC-T2A-rev1 NA GCATGTTAGAAGACTTCCTCTGCCCTCATAATCAAACCCCTCTCT
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull NITGC-T2A-rev2 NA AGGGCCGGGATTCTCCTCCACGTCACCGCATGTTAGAAGACTTCC
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull NITGC-T2A-rev3 NA TGCTCACCATAGGGCCGGGATTCTCCTC
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull cGull-fwd NA TCCCGGCCCTATGGTGAGCAAGGGCGAG
Recombinant DNA reagent kozak-NITGC2-T2A-Green cGull cGull-rev NA ACCAAGCTTAAGTTTAAACGTTACTTGTACAGCTCGTCCATG
Recombinant DNA reagent Green cGull-T2A-NITGC2 & NITGC2-T2A-Green cGull NITGC2_seq_743_fwd NA AGCCATCTACGAGTGGTA
Recombinant DNA reagent Green cGull-T2A-NITGC2 & NITGC2-T2A-Green cGull cGull_seq_385_rev NA TGCCCTTCAGCTCGATG
Recombinant DNA reagent Green cGull-T2A-NITGC2 & NITGC2-T2A-Green cGull NITGC2_seq_743_rev NA TGACTGACGAACCCTCC
Recombinant DNA reagent Green cGull-T2A-NITGC2 & NITGC2-T2A-Green cGull NITGC2_seq_394_fwd NA AGATATCTTGAAACGGACGA
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull 2A-cGull_invF_L1 NA TGACGTGGAGGAGAATCCCGGCCCTATGGTGAGCAAGGGCGAGGAGCTGT
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull 2A-cGull_invF_L2 NA GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull 2A-cGull_invR_L NA TCCTTGCTTGTCATGGTGGCCCAGCTTGGGTCTCCCTATAGTGAGTCGTA
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1-2A_F_L NA GAGACCCAAGCTGGGCCACCATGACAAGCAAGGAGATGCCTGTACTCATG
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1-2A_R_L NA TGTTAGAAGACTTCCTCTGCCCTCTATGACTTTTTCTATGCTTTCTTCGG
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1seq_remo_invF2 NA AGCGTGGAGGTGGGCCTAGACGAAAGAGCTGAAAA
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1seq_remo_invR2 NA AGCTCTTTCGTCTAGGCCCACCTCCACGCTGAATA
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1seq_remo_F2 NA GCCGGTCTTGTCGATCAGGATGATCTGGAC
Recombinant DNA reagent kozak-NIT1(seq)-T2A-Green cGull NIT1seq_remo_R2 NA GTCCAGATCATCCTGATCGACAAGACCGGC
Recombinant DNA reagent pUC57-NOSp::Palmi-3xHA-tdTomato (plasmid) This paper NA Promoter construct: injected at 250 ng/μl
Recombinant DNA reagent pUC57-T7-RPP2-tdTomato-P2A-GCaMP6 (plasmid) This paper NA Used for generating tdTomato-P2A-GCaMP6s mRNA
Plasmid Green cGull Addgene Plasmid #86867 NA
HCR NOS Integrated DNA Technologies NA NA
HCR NIT-GC1 Integrated DNA Technologies NA NA
HCR NIT-GC2 Integrated DNA Technologies NA NA
HCR RYa-pNP (GenBank accession: JF811330.1) Integrated DNA Technologies NA NA
HCR c-opsin1 (GenBank accession: AY692353.1) Integrated DNA Technologies NA NA
HCR MLD/pedal2-pNP (GenBank accession: KF515945.1) Integrated DNA Technologies NA NA
HCR CNGAα (GenBank accession: KM199644.1) Integrated DNA Technologies NA NA
fluorescently labeled hairpins B2-647 Molecular Technologies NA NA
fluorescently labeled hairpins B3-546 Molecular Technologies NA NA
morpholino NIT-GC1 MO1 Gene-Tools, LLC NA TGCTTGTCATTATTCAACCAGCAAA
morpholino NIT-GC1 MO2 Gene-Tools, LLC NA TTCAATTAAACCCTCCAGGTTGCTG
morpholino NIT-GC2 MO1 Gene-Tools, LLC NA AAATGAAGAGAGGTGTTCTCCTTCG
morpholino NIT-GC2 MO2 Gene-Tools, LLC NA ATATTCATTATGTGAAGAACTTCCA
plasmid for mRNA synthase (GCaMP6s) BamHI-T7::RPP2(5UTR)-GCaMP6s(AscI-AgeI)-polyA_KpnI_c1 NA Plasmid Bezares-Calderón et al., 2018
plasmid for mRNA synthase (RGECO1a) PUC57-T7-PduRPP2(5UTR)-jRGECO1a NA Plasmid Bezares-Calderón et al., 2018
Chemical compound, drug SNAP Sigma-Aldrich Cat#:M9020 500 μM
Chemical compound, drug L-NAME Sigma-Aldrich Cat#:M9021 501 μM
Commercial assay or kit Phusion Human Specimen Direct PCR Kit Thermofisher NA NA
Commercial assay or kit mMESSAGE mMACHINE Sp6 kit Thermofisher NA NA
Software, algorithm Golden Gate TAL Addgene 1000000024 NA NA
Software, algorithm Effector Kit 2.0, Fiji perl and Fiji scripts for tracking PMID: 22743772, https://github.com/JekelyLab/Veraszto_et_al_2018 RRID:SCR_002285 0000d2a
Commercial assay or kit QuickExtract Epicentre,US Cat#:QE09050 NA
Commercial assay or kit MEGAshortscript T7 Transcription Kit Ambion, ThermoFisher Scientific Cat#:AM1354 NA
Commercial assay or kit mMESSAGE mMACHINE T7 ULTRA Transcription Kit Ambion, ThermoFisher Scientific Cat#:AM1345 NA
Commercial assay or kit MEGAclear Transcription Clean-Up Kit Ambion, ThermoFisher Scientific Cat#:AM1908 NA
Software, algorithm Fiji NIH RRID:SCR_002285 NA
Software, algorithm R Project for Statistical Computing R Foundation RRID:SCR_001905 NA
Software, algorithm Imaris Version 8.0.0 Bitplane, UK. RRID:SCR_007370 NA
Software, algorithm CATMAID DOI:10.1093/bioinformatics/btp266 RRID:SCR_006278 NA
Software, algorithm PhyML DOI:10.1093/sysbio/syq010 RRID:SCR_014629 NA
Software, algorithm Gblocks DOI:10.1080/10635150701472100 RRID:SCR_015945 NA

Materials and Methods

CRISPR-Cas9 Design and Microinjection

Before designing the small guide RNA (sgRNA) for the sgRNA:Cas9 nuclease, splice sites and polymorphic sites in our laboratory culture were identified to avoid them. The sgRNA targeted the third exon of Platynereis dumerilii NOS (target site: 5’-GGGCAATACTGGCTCCACTC-3’). The sgRNA was assembled from two annealed oligonucleotides (5’-TAGGGCAATACTGGCTCCACTC-3’, 5’-AAACGAGTGGAGCCAGTATTGC-3’) forming overhangs for cloning into a BsaI site of the plasmid pDR27456 (Hwang et al. 2013)(42250, Addgene), which contains next to the BsaI site a tracrRNA sequence. The plasmid was then used to PCR amplify DNA (primers: T7, 5’-AAAAGCACCGACTCGGTGCC-3’) for synthesizing the sgRNA. The DNA was purified with the QIAquick PCR Purification Kit (Qiagen). From the DNA, the sgRNA was synthesized with the MEGAshortscript Kit (Thermo Fisher Scientific) and was purified with the MEGAclear Kit (Thermo Fisher Scientific). Cas9-mRNA was transcribed, capped, and polyA-tailed with the mMessage mMachine Kit and the Poly(A) Tailing Kit (both Thermo Fisher Scientific) from a plasmid (pUC57-T7-RPP2-Cas9) containing the Cas9 ORF fused to 169 base pair 5’ UTR from the Platynereis dumerilii 60S acidic ribosomal protein P2. The sgRNA (18 ng/ml) and the Cas9-mRNA (180 ng/µl) were coinjected into fertilized eggs of Platynereis dumerilii wild-type parents according to an established injection procedure (Conzelmann et al., 2013). The eggs were kept at 18°C for 45 min before injection and were injected at 14.5°C. The injected individuals were kept at 18°C for 5 to 8 days in 6-well- plates (Nunc multidish no. 150239, Thermo Scientific) and then cultured at 22°C until sexual maturity. The mature worms were crossed to wild-type worms and the progeny was genotyped, resulting in two founder lines, which were bred to homozygosity.

NOS sequencing and genotyping

For genotyping of the NOS locus, genomic DNA was isolated from single larvae, groups of 6-20 larvae, or from the tails of adult worms. The DNA was amplified by PCR (primers: 5’-GGTTCATTGGTTTCGATAACATTGCGG-3’, 5’-CAGAGTCGATCAGTCTGCATATCTCCA-3’) with the dilution protocol of the Phusion Human Specimen Direct PCR Kit (Thermo Scientific). The PCR product was sequenced directly with a nested sequencing primer (5’-GGTGCTCTCCCGGGTACACAA-3’). A mixture of wild-type and deletion alleles in a sample gave double peaks in the sequencing chromatograms, with the relative height of the double peaks reflecting the relative allele ratio in the sample.

Vertical column setup for measuring photoresponses

Photoresponses of larvae of different ages were assayed in a vertical Plexiglas column (31 mm x 10 mm x 160 mm water height). The column was illuminated from top with light from a monochromator (Polychrome II, Till Photonics). The monochromator was controlled by AxioVision 4.8.2.0 (Carl Zeiss MicroImaging GmbH) via analog voltage. The light passed a collimator lens (LAG-65.0-53.0-C with MgF2 Coating, CVI Melles Griot) before entering the column. The column was illuminated from both sides with light-emitting diodes (LEDs). The LEDs on each side were grouped into two strips. One strip contained UV (395 nm) LEDs (SMB1W-395, Roithner Lasertechnik) and the other infrared (810 nm) LEDs (SMB1W-810NR-I, Roithner Lasertechnik). The UV LEDs were run at 4 V to stimulate the larvae in the column from the side. The infrared LEDs were run at 8 V (overvoltage) to illuminate the larvae for the camera (DMK 22BUC03, The Imaging Source), which recorded videos at 15 frames per second and was controlled by IC Capture (The Imaging Source).

Comparing behavior of wildtype and NOS-knockout 3-day-old larvae

To compare the behavior of wildtype and NOS-knockout larvae at 3 days in the vertical column, the larvae were mixed and left in the dark for 5 min. The larvae were treated with NOS inhibitors for pharmacology. The NOS inhibitors were L-NAME. The larvae were treated with different concentrations in adjacent columns. The concentrations for the NOS inhibitors were control, 1 mM, 0.1 mM. The larvae were recorded for 1 min in the dark followed by exposure to collimated cyan (480 nm) light from the top of the column for 2 min, then 2 min darkness, and finally collimated UV (395 nm) light from the top of the column for 2 min. Stimulus light was provided by the monochromator (Polychrome II, Till Photonics). Scripts are available at https://github.com/JekelyLab/NOS.

NOS Identification and Phylogenetic Analysis

To identify NOS, we obtained a “seed” database of oxygenase domain in Pfam database, PF02898. From these sequences, we produced a Hidden Markov Model (HMM) and used this to mine the 47 metazoan species, 2 choanoflagellate species and 2 filasterea species investigated. HMM models were run in HMMR3 with an e-value of 1e−15. We ran CD-Hit (Fu et al., 2012) to eliminate redundant sequences (at a 80% threshold). We aligned the sequences with MAFFT version 7, with the iterative refinement method E-INS-i. Alignments were trimmed with TrimAl in gappy-out mode (Capella-Gutierrez et al., 2009). To calculate maximum-likelihood trees, we used IQ-tree2 with the LG+G4 model. To calculate branch support, we ran 1,000 replicates with the aLRT-SH-like and aBayes methods (Minh et al., 2020). The sequences used for the phylogenetic analysis are available in Supplementary File 1, the trimmed alignment is available in Supplementary File 2 and the pre-trimmed data in Supplementary file 3.

NIT-GC Identification and Phylogenetic Analysis

To identify NIT-GCs, we obtained a “seed” database of Adenylate and Guanylate cyclase catalytic domain in Pfam database, PF00211. From these sequences, we produced a Hidden Markov Model (HMM) and used this to mine the 45 metazoan species, 2 choanoflagellate species and 2 filasterea species investigated. HMM models were run in HMMR3 with an e-value of 1e−15. We ran CD-Hit (Fu et al., 2012) to eliminate redundant sequences (at a 80% threshold). To identify clusters, we used the convex-clustering option with 100 jack-knife replicates. The NIT-GCs are extremely well conserved in membrane-bound guanylate cyclases and form an easily recognizable cluster. To analyze the phylogeny of NIT-GCs, the cluster containing these GCs together with membrane-bound guanylate cyclases were parsed and used for tree building. We aligned the sequences with MAFFT version 7, with the iterative refinement method E-INS-i. Alignments were trimmed with TrimAl in gappy-out mode (Capella-Gutierrez et al., 2009). To calculate maximum-likelihood trees, we used IQ-tree2 with the LG+G4 model. To calculate branch support, we ran 1,000 replicates with the aLRT-SH-like and aBayes methods (Minh et al., 2020). The sequences used for the phylogenetic analysis are available in Supplementary File 1, the trimmed alignment is available in Supplementary File 2 and the pre-trimmed data in Supplementary file 3.

Single-cell analysis

We used Achim et al. for the single-cell data (Achim et al., 2015). In Williams et al., they used 107 cells as neurons by removing duplicates from Achim et al. single-cell data, so we used those cells (Williams et al., 2017). Since the raw data were read count data, we normalized them to TPM using Python. After that we converted them to log10. From the sum of the expression levels in 107 cells for each gene, We calculated the percentage in each cell. For each cell, we identified them with marker genes. After created the data in Python, plotted it using R dot plots. RPKM calculates the total number of reads per million bp and then divides by the length of each gene, so it is not possible to compare between samples. Instead, TPM first divides by the length of the gene and then divides by the total number of reads per million bases, which allows for more accurate comparisons between samples. In this case we wanted to compare between samples, so we used TPM. The total TPM of each gene between the samples was used to calculate the percentage of expressed genes. The total TPM values for each gene and the percentage of expressed genes are available in Supplementary file 1.

In situ HCR

Larvae were fixed and treated with Proteinase K, according to the conventional WMISH protocol (Tessmar-Raible et al., 2005), with fixation in 4% paraformaldehyde/ PTW (PBS with 0.05% Tween20) for 2 hr at room temperature, and Proteinase K treatment in 100 µg/ml Proteinase K/ PTW for 3 min (Tessmar-Raible et al., 2005). Specifically, for the HCR protocol, samples were processed in 1.5 ml tubes. Probe hybridization buffer, probe wash buffer, amplification buffer, and fluorescent HCR hairpins were purchased from Molecular Instruments (Los Angeles, USA). Hairpins associated with the b2 initiator sequence were labeled with Alexa Fluor 647, and the hairpins associated with the b3 initiator sequence were labeled with Alexa Fluor 546. To design probes for HCR, we used custom software (Kuehn et al., 2021) to create 20 DNA oligo probe pairs specific to P. dumerilii NOS, NIT-GC1, NIT-GC2, RYa-pNP (GenBank accession: JF811330.1), and MLD/pedal 2-pNP (GenBank accession: KF515945.1). The NOS, NIT-GC1 and NIT-GC2 probes were designed to be associated with the b2 initiator sequence, while the RYa-pNP and MLD/pedal 2-pNP probes were designed to be associated with the b3 initiator sequence. For the detection stage, samples were pre-hybridized in 200 µl of probe hybridization buffer for 1 hr at 37°C, and then incubated in 250 µl hybridization buffer containing probe oligos (4 pmol/ml) overnight at 37°C. To remove excess probe, samples were washed 4× with 1 ml hybridization wash buffer for 15 min at 37°C, and subsequently 2× in 1 ml 5× SSCT (5× SSC with 0.1% Tween20) for 5 min at room temperature. For the amplification stage, samples were pre-incubated with 100 µl of amplification buffer for 30 min, room temperature, and then incubated with 150 µl amplification buffer containing fluorescently labeled hairpins (40nM concentration (2ul of 3uM stock in 150ul amplification buffer, snap-cooled as described; (Choi et al., 2018)) overnight in the dark at 25°C. To remove excess hairpins, samples were washed in 1 ml 5× SSCT at room temperature, twice for 5 min, twice for 30 min, and once for 5 min. During the first 30 min wash, samples were counterstained with DAPI (Cat. #40043, Biotium, USA).

Immunohistochemistry

Whole-mount immunostaining of 2 day old Platynereis larvae fixed with 4% paraformaldehyde were carried out using primary antibodies raised against NIT-GC1, NIT-GC2, NOS, RYamide neuropeptide, RGWamide neuropeptide in rabbit, plus a commercial antibody raised against acetylated tubulin in mouse (Sigma T7451). The synthetic peptides contained an N-terminal Cys that was used for coupling during purification. Antibodies were affinity purified from sera as previously described (Conzelmann and Jékely, 2012). Immunostainings were carried out as previously described (Conzelmann and Jékely, 2012). The NOS promoter (fragment sizes: 12 Kb) was amplified and cloned upstream of 3xHA- Palmi-tdTomato. Larvae injected with promoter constructs (ca. 250 ng/ml) were analysed for reporter expression at 3 days post fertilization using an AxioImager Z.1 fluorescence wide-field microscope (Carl Zeiss GmbH, Jena) and immediately fixed for immunostainings. The protocol followed for immunostaining of HA-tagged reporters was recently described (Verasztó et al., 2017). Specimens were imaged with a LSM 780 NLO or LSM 880 with Airysan Confocal Microscope (Zeiss, Jena).

Calcium imaging

For calcium imaging, 49–55 hpf larvae were used. Experiments were performed at room temperature and larvae were immobilised by being embedded in 2.5% agarose filtered artificial seawater between a slide and coverslip spaced with adhesive tape. GCaMP6s mRNA (1 mg/ml) was injected into zygotes as described previously (Randel et al., 2014). Larvae were imaged on a Zeiss LSM 880 with Airyscan (with a C-Apochromat 63X/1.2 Corr - water) with a frame rate of 1.88 frame/sec and an image size of 512 x 512 pixels. The larvae were stimulated in a region of interest (a circle with 50 pixel diameter) with 405 nm lasers controlled by the Bleaching mode. The imaging laser had a similar intensity than the stimulus laser but covered an area that was 10 times larger than the stimulus ROI.

Cell culture experiment

Green cGull was used for the cGMP assay (Matsuda et al., 2016). A full-length Pdum-NIT-GC1 and -NIT-GC2 coding sequences were amplified by PCR starting from a Platynereis dumerilii cDNA library and cloned into the pcDNA3.1(+) vector using the T2A self-cleaving sequence. Cos-7 cells with low expression of endogenous soluble guanylate cyclase were used as cultured cells for gene expression. This cell line was purchased from Angio-proteomie (CAT no. cAP-0203). The Cos-7 cells were maintained at 37 °C in 35mm dishes (Nunc™ Glass Bottom Dishes) containing 3 mL of DMEM, high glucose glutamax medium (Thermo; Cat. No. 10566016) supplemented with 10% fetal bovine serum (Thermo; Cat. No. 10082147). Upon reaching confluency of approximately 85%, we transfected the cells with the plasmid containing Green cGull-T2A-NITGC1. Transfections were carried out with 150 ng of each plasmid and 0.3 μl of the transfection Lipofectamine 3000 Reagent (invitrogen; Cat. No. L3000001). Two days post-transfection, we removed the culture medium and substituted it for fresh DMEM-medium. For single-wavelength imaging experiments, cells in 35-mm dishes were washed twice and imaged in modified Ringer’s buffer (140 mM NaCl, 3.5 mM KCl, 0.5mM NaH2PO4 , 0.5mM S-3 MgSO4 , 1.5 mM CaCl2 , 10 mM HEPES, 2 mM NaHCO3 and 5 mM glucose). Dishes were mounted on a stage heated at 37 °C and imaging was performed using an inverted microscope (LSM880, Zeiss) equipped with an oil-immersion objective lens (UApo/340, 40, NA = 0.17). Images were acquired using a xenon lamp, 460–495 nm excitation filter, 505-nm dichroic mirror and 510– 550-nm emission filter (Zeiss). S-Nitroso-N-acetyl-D, L-penicillamine (SNAP) was purchased from Sigma-Aldrich (St. Louis, MO, USA) . The exposure time of the EM-CCD camera was controlled by the ZEN software (Zeiss). Images were acquired every 15 s for 10 min and stimulation was initiated 2 min after starting image acquisition. Imaging data analysis was performed using ImageJ (National Institutes of Health, Bethesda, MD, USA).

Acknowledgements

This work was funded by the Wellcome Trust (214337/Z/18/Z).

References

Achim K, Pettit J-B, Saraiva LR, Gavriouchkina D, Larsson T, Arendt D, Marioni JC. 2015. High-throughput spatial mapping of single-cell RNA-seq data to tissue of origin. Nature Biotechnology 33:503–509. doi:10.1038/nbt.3209
Arendt D, Tessmar-Raible K, Snyman H, Dorresteijn AW, Wittbrodt J. 2004. Ciliary Photoreceptors with a Vertebrate-Type Opsin in an Invertebrate Brain. Science 306:869–871. doi:10.1126/science.1099955
Aso Y, Ray RP, Long X, Bushey D, Cichewicz K, Ngo T-T, Sharp B, Christoforou C, Hu A, Lemire AL, Tillberg P, Hirsh J, Litwin-Kumar A, Rubin GM. 2019. Nitric oxide acts as a cotransmitter in a subset of dopaminergic neurons to diversify memory dynamics. eLife 8. doi:10.7554/elife.49257
Bishop CD, Brandhorst BP. 2007. Development of nitric oxide synthase-defined neurons in the sea urchin larval ciliary band and evidence for a chemosensory function during metamorphosis. Developmental Dynamics 236:1535–1546. doi:10.1002/dvdy.21161
Bray SR, Wyss LS, Chai C, Lozada ME, Wang B. 2023. Adaptive robustness through incoherent signaling mechanisms in a regenerative brain.
Bredt DS, Hwang PM, Snyder SH. 1990. Localization of nitric oxide synthase indicating a neural role for nitric oxide. Nature 347:768–770. doi:10.1038/347768a0
Burette A, Zabel U, Weinberg RJ, Schmidt HHHW, Valtschanoff JG. 2002. Synaptic Localization of Nitric Oxide Synthase and Soluble Guanylyl Cyclase in the Hippocampus. The Journal of Neuroscience 22:8961–8970. doi:10.1523/jneurosci.22-20-08961.2002
Camargo A, Llamas A, Schnell RA, Higuera JoseJ́, Gonzaĺez-Ballester D, Lefebvre PA, Fernańdez E, Galvań A. 2007. Nitrate Signaling by the Regulatory GeneNIT2inChlamydomonas. The Plant Cell 19:3491–3503. doi:10.1105/tpc.106.045922
Capella-Gutierrez S, Silla-Martinez JM, Gabaldon T. 2009. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25:1972–1973. doi:10.1093/bioinformatics/btp348
Choi HMT, Schwarzkopf M, Fornace ME, Acharya A, Artavanis G, Stegmaier J, Cunha A, Pierce NA. 2018. Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust. Development 145. doi:10.1242/dev.165753
Conzelmann M, Jékely G. 2012. Antibodies against conserved amidated neuropeptide epitopes enrich the comparative neurobiology toolbox. EvoDevo 3:23. doi:10.1186/2041-9139-3-23
Conzelmann M, Offenburger S-L, Asadulina A, Keller T, Münch TA, Jékely G. 2011. Neuropeptides regulate swimming depth of Platynereis larvae. Proceedings of the National Academy of Sciences 108. doi:10.1073/pnas.1109085108
Conzelmann M, Williams EA, Krug K, Franz-Wachtel M, Macek B, Jékely G. 2013. The neuropeptide complement of the marine annelid Platynereis dumerilii. BMC Genomics 14:906. doi:10.1186/1471-2164-14-906
Cudeiro J, Rivadulla C. 1999. Sight and insight on the physiological role of nitric oxide in the visual system. Trends in Neurosciences 22:109–116. doi:10.1016/s0166-2236(98)01299-5
Fu L, Niu B, Zhu Z, Wu S, Li W. 2012. CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics 28:3150–3152. doi:10.1093/bioinformatics/bts565
Garthwaite J. 2015. From synaptically localized to volume transmission by nitric oxide. The Journal of Physiology 594:9–18. doi:10.1113/jp270297
Gibbs SM, Truman JW. 1998. Nitric Oxide and Cyclic GMP Regulate Retinal Patterning in the Optic Lobe of Drosophila. Neuron 20:83–93. doi:10.1016/s0896-6273(00)80436-5
Hölscher C. 1997. Nitric oxide, the enigmatic neuronal messenger: its role in synaptic plasticity. Trends in Neurosciences 20:298–303. doi:10.1016/s0166-2236(97)01065-5
Imambocus BN, Zhou F, Formozov A, Wittich A, Tenedini FM, Hu C, Sauter K, Macarenhas Varela E, Herédia F, Casimiro AP, Macedo A, Schlegel P, Yang C-H, Miguel-Aliaga I, Wiegert JS, Pankratz MJ, Gontijo AM, Cardona A, Soba P. 2022. A neuropeptidergic circuit gates selective escape behavior of Drosophila larvae. Current Biology 32:149–163.e8. doi:10.1016/j.cub.2021.10.069
Jacoby J, Nath A, Jessen ZF, Schwartz GW. 2018. A Self-Regulating Gap Junction Network of Amacrine Cells Controls Nitric Oxide Release in the Retina. Neuron 100:1149–1162.e5. doi:10.1016/j.neuron.2018.09.047
Kuehn E, Clausen DS, Null RW, Metzger BM, Willis AD, Özpolat BD. 2021. Segment number threshold determines juvenile onset of germline cluster expansion in Platynereis dumerilii. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 338:225–240. doi:10.1002/jez.b.23100
Kuntz S, Poeck B, Strauss R. 2017. Visual Working Memory Requires Permissive and Instructive NO/cGMP Signaling at Presynapses in the Drosophila Central Brain. Current Biology 27:613–623. doi:10.1016/j.cub.2016.12.056
Leise EM, Thavaradhara K, Durham NR, Turner BE. 2001. Serotonin and Nitric Oxide Regulate Metamorphosis in the Marine SnailIlyanassa obsoleta. American Zoologist 41:258–267. doi:10.1093/icb/41.2.258
Locascio A, Vassalli QA, Castellano I, Palumbo A. 2022. Novel Insights on Nitric Oxide Synthase and NO Signaling in Ascidian Metamorphosis. International Journal of Molecular Sciences 23:3505. doi:10.3390/ijms23073505
Lundberg JO, Weitzberg E, Shiva S, Gladwin MT. 2011. The nitratenitritenitric oxide pathway in mammals. Humana Press. pp. 21–48. doi:10.1007/978-1-60761-616-0_3
Matsuda S, Harada K, Ito M, Takizawa M, Wongso D, Tsuboi T, Kitaguchi T. 2016. Generation of a cGMP Indicator with an Expanded Dynamic Range by Optimization of Amino Acid Linkers between a Fluorescent Protein and PDE5? ACS Sensors 2:46–51. doi:10.1021/acssensors.6b00582
Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Haeseler A von, Lanfear R. 2020. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution 37:1530–1534. doi:10.1093/molbev/msaa015
Mobley RB, Ray EJ, Maruska KP. 2022. Expression and localization of neuronal nitric oxide synthase in the brain and sensory tissues of the African cichlid fish Astatotilapia burtoni. Journal of Comparative Neurology 530:2901–2917. doi:10.1002/cne.25383
Möller MN, Rios N, Trujillo M, Radi R, Denicola A, Alvarez B. 2019. Detection and quantification of nitric oxidederived oxidants in biological systems. Journal of Biological Chemistry 294:14776–14802. doi:10.1074/jbc.rev119.006136
Moroz LL, Meech RW, Sweedler JV, Mackie GO. 2004. Nitric oxide regulates swimming in the jellyfishAglantha digitale. The Journal of Comparative Neurology 471:26–36. doi:10.1002/cne.20023
Moroz LL, Romanova DY, Nikitin MA, Sohn D, Kohn AB, Neveu E, Varoqueaux F, Fasshauer D. 2020. The diversification and lineage-specific expansion of nitric oxide signaling in Placozoa: insights in the evolution of gaseous transmission. Scientific Reports 10. doi:10.1038/s41598-020-69851-w
Ozpolat BD, Randel N, Williams EA, Bezares-Calderón LA, Andreatta G, Balavoine G, Bertucci PY, Ferrier DEK, Gambi MC, Gazave E, Handberg-Thorsager M, Hardege J, Hird C, Hsieh Y-W, Hui J, Mutemi KN, Schneider SQ, Simakov O, Vergara HM, Vervoort M, Jékely G, Tessmar-Raible K, Raible F, Arendt D. 2021. The Nereid on the rise: Platynereis as a model system. Zenodo. doi:10.5281/ZENODO.4907400
Randel N, Asadulina A, Bezares-Calderón LA, Verasztó C, Williams EA, Conzelmann M, Shahidi R, Jékely G. 2014. Neuronal connectome of a sensory-motor circuit for visual navigation. eLife 3. doi:10.7554/elife.02730
Santos RM, Lourenço CF, Pomerleau F, Huettl P, Gerhardt GA, Laranjinha J, Barbosa RM. 2011. Brain Nitric Oxide Inactivation Is Governed by the Vasculature. Antioxidants & Redox Signaling 14:1011–1021. doi:10.1089/ars.2010.3297
Shettigar N, Chakravarthy A, Umashankar S, Lakshmanan V, Palakodeti D, Gulyani A. 2021. Discovery of a body-wide photosensory array that matures in an adult-like animal and mediates eyebrain-independent movement and arousal. Proceedings of the National Academy of Sciences 118. doi:10.1073/pnas.2021426118
Shu CJ, Ulrich LE, Zhulin IB. 2003. The NIT domain: a predicted nitrate-responsive module in bacterial sensory receptors. Trends in Biochemical Sciences 28:121–124. doi:10.1016/s0968-0004(03)00032-x
Song H, Hewitt OH, Degnan SM. 2021. Arginine Biosynthesis by a Bacterial Symbiont Enables Nitric Oxide Production and Facilitates Larval Settlement in the Marine-Sponge Host. Current Biology 31:433–437.e3. doi:10.1016/j.cub.2020.10.051
Tessmar-Raible K, Steinmetz PRH, Snyman H, Hassel M, Arendt D. 2005. Fluorescent two-color whole mount in situ hybridization in Platynereis dumerilii (Polychaeta, Annelida), an emerging marine molecular model for evolution and development. BioTechniques 39:460–464. doi:10.2144/000112023
Thomas DD. 2015. Breathing new life into nitric oxide signaling: A brief overview of the interplay between oxygen and nitric oxide. Redox Biology 5:225–233. doi:10.1016/j.redox.2015.05.002
Tooker RE, Lipin MY, Leuranguer V, Rozsa E, Bramley JR, Harding JL, Reynolds MM, Vigh J. 2013. Nitric Oxide Mediates Activity-Dependent Plasticity of Retinal Bipolar Cell Output via S-Nitrosylation. The Journal of Neuroscience 33:19176–19193. doi:10.1523/jneurosci.2792-13.2013
Tosches MA, Bucher D, Vopalensky P, Arendt D. 2014. Melatonin Signaling Controls Circadian Swimming Behavior in Marine Zooplankton. Cell 159:46–57. doi:10.1016/j.cell.2014.07.042
Tsukamoto H, Chen I-S, Kubo Y, Furutani Y. 2017. A ciliary opsin in the brain of a marine annelid zooplankton is ultraviolet-sensitive, and the sensitivity is tuned by a single amino acid residue. Journal of Biological Chemistry 292:12971–12980. doi:10.1074/jbc.m117.793539
Tsukamoto H, Kubo Y. 2023. A self-inactivating invertebrate opsin optically drives biased signaling toward Gβγ-dependent ion channel modulation. Proceedings of the National Academy of Sciences 120. doi:10.1073/pnas.2301269120
Ueda N, Richards GS, Degnan BM, Kranz A, Adamska M, Croll RP, Degnan SM. 2016. An ancient role for nitric oxide in regulating the animal pelagobenthic life cycle: evidence from a marine sponge. Scientific Reports 6. doi:10.1038/srep37546
Veedin Rajan VB, Häfker NS, Arboleda E, Poehn B, Gossenreiter T, Gerrard E, Hofbauer M, Mühlestein C, Bileck A, Gerner C, Ribera d’Alcala M, Buia MC, Hartl M, Lucas RJ, Tessmar-Raible K. 2021. Seasonal variation in UVA light drives hormonal and behavioural changes in a marine annelid via a ciliary opsin. Nature Ecology & Evolution 5:204–218. doi:10.1038/s41559-020-01356-1
Verasztó C, Gühmann M, Jia H, Rajan VBV, Bezares-Calderón LA, Piñeiro-Lopez C, Randel N, Shahidi R, Michiels NK, Yokoyama S, Tessmar-Raible K, Jékely G. 2018. Ciliary and rhabdomeric photoreceptor-cell circuits form a spectral depth gauge in marine zooplankton. eLife 7. doi:10.7554/elife.36440
Verasztó C, Jasek S, Gühmann M, Shahidi R, Ueda N, Beard JD, Mendes S, Heinz K, Bezares-Calderón LA, Williams E, Jékely G. 2020. Whole-animal connectome and cell-type complement of the three-segmented Platynereis dumerilii larva.
Verasztó C, Ueda N, Bezares-Calderón LA, Panzera A, Williams EA, Shahidi R, Jékely G. 2017. Ciliomotor circuitry underlying whole-body coordination of ciliary activity in the Platynereis larva. eLife 6. doi:10.7554/elife.26000
Vergara HM, Pape C, Meechan KI, Zinchenko V, Genoud C, Wanner AA, Mutemi KN, Titze B, Templin RM, Bertucci PY, Simakov O, Dürichen W, Machado P, Savage EL, Schermelleh L, Schwab Y, Friedrich RW, Kreshuk A, Tischer C, Arendt D. 2021. Whole-body integration of gene expression and single-cell morphology. Cell 184:4819–4837.e22. doi:10.1016/j.cell.2021.07.017
Vielma AH, Agurto A, Valdés J, Palacios AG, Schmachtenberg O. 2014. Nitric Oxide Modulates the Temporal Properties of the Glutamate Response in Type 4 OFF Bipolar Cells. PLoS ONE 9:e114330. doi:10.1371/journal.pone.0114330
Wang G-Y, List DA van der, Nemargut JP, Coombs JL, Chalupa LM. 2007. The sensitivity of light-evoked responses of retinal ganglion cells is decreased in nitric oxide synthase gene knockout mice. Journal of Vision 7:7. doi:10.1167/7.14.7
Wei T, Schubert T, Paquet-Durand F, Tanimoto N, Chang L, Koeppen K, Ott T, Griesbeck O, Seeliger MW, Euler T, Wissinger B. 2012. Light-Driven Calcium Signals in Mouse Cone Photoreceptors. Journal of Neuroscience 32:6981–6994. doi:10.1523/jneurosci.6432-11.2012
Wildemann B, Bicker G. 1999. Developmental expression of nitric oxide/cyclic GMP synthesizing cells in the nervous system ofDrosophila melanogaster. Journal of Neurobiology 38:1–15. doi:10.1002/(sici)1097-4695(199901)38:1<1::aid-neu1>3.0.co;2-l
Williams EA, Verasztó C, Jasek S, Conzelmann M, Shahidi R, Bauknecht P, Mirabeau O, Jékely G. 2017. Synaptic and peptidergic connectome of a neurosecretory center in the annelid brain. eLife 6. doi:10.7554/elife.26349
Zhang Y, He L-S, Zhang G, Xu Y, Lee O-O, Matsumura K, Qian P-Y. 2012. The regulatory role of the NO/cGMP signal transduction cascade during larval attachment and metamorphosis of the barnacleBalanus (=Amphibalanus) amphitrite. Journal of Experimental Biology. doi:10.1242/jeb.070235

Figure supplements

**Figure 1 -- figure supplement 1**  Phylogenetic tree of NOS by maximum likelihood. Tree robustness was tested with 1000 replicates of ultrafast bootstrap with the aLRT-SH-like and aBayes methods.

Figure 1 – figure supplement 1 Phylogenetic tree of NOS by maximum likelihood. Tree robustness was tested with 1000 replicates of ultrafast bootstrap with the aLRT-SH-like and aBayes methods.

**Figure 1 -- figure supplement 2** Expression analysis of the *NOS* gene (magenta) using in situ HCR using the larva at three-day-old in dorsal **(A)** and anterior view (B). (B) Insert: showing two NOS cells (INNOS_dl and INNOS_vl) on left side.

Figure 1 – figure supplement 2 Expression analysis of the NOS gene (magenta) using in situ HCR using the larva at three-day-old in dorsal (A) and anterior view (B). (B) Insert: showing two NOS cells (INNOS_dl and INNOS_vl) on left side.

**Figure 1 -- figure supplement 3** ssTEM reconstruction of the INNOS (A), INRGW (B) and cPRC (C), anterior view. NS plexus; neurosecretory plexus

Figure 1 – figure supplement 3 ssTEM reconstruction of the INNOS (A), INRGW (B) and cPRC (C), anterior view. NS plexus; neurosecretory plexus

**Figure 3 -- figure supplement 1** **(A)** Top: The domain and Exon/Intron structure of NOS. Bottom: Close-up region showing the genomic locus of NOS gene and the wild-type sequence (WT) targeted by CRISPR/Cas9. The generated mutants (NOSΔ11, NOSΔ23) are also shown. Pink indicates target sites. Gray shows PAM sequences, red shows stop codons. **(B)** Overlaid trajectories for WT (n=37) and NOS mutant (NOSΔ11/Δ11, n=18 and NOSΔ23/Δ23, n=8) at two-day-old larvae. 0 sec as the starting point. After 10 sec, UV (395 nm) stimulation from the side. **(C)** The temporal changes in the vertical position of the WT and mutant two-days-old larvae before and after UV stimulation are shown. The starting points of each larval trajectory are set to 0. After UV stimulation is indicated by purple squares. **(D, E)** The temporal changes in the distance traveled of the WT and mutant in two-day (D) and three-day-old (E) larvae before and after UV stimulation are shown. **(F)** The temporal changes in the distance traveled of larvae treated with NOS inhibitors, L-NAME in three-day larvae before and after UV stimulation are shown. **(G)** Vertical swimming in wild-type (WT) and mutant (NOSΔ11 and NOSΔ23) larvae at two-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins.

Figure 3 – figure supplement 1 (A) Top: The domain and Exon/Intron structure of NOS. Bottom: Close-up region showing the genomic locus of NOS gene and the wild-type sequence (WT) targeted by CRISPR/Cas9. The generated mutants (NOSΔ11, NOSΔ23) are also shown. Pink indicates target sites. Gray shows PAM sequences, red shows stop codons. (B) Overlaid trajectories for WT (n=37) and NOS mutant (NOSΔ11/Δ11, n=18 and NOSΔ23/Δ23, n=8) at two-day-old larvae. 0 sec as the starting point. After 10 sec, UV (395 nm) stimulation from the side. (C) The temporal changes in the vertical position of the WT and mutant two-days-old larvae before and after UV stimulation are shown. The starting points of each larval trajectory are set to 0. After UV stimulation is indicated by purple squares. (D, E) The temporal changes in the distance traveled of the WT and mutant in two-day (D) and three-day-old (E) larvae before and after UV stimulation are shown. (F) The temporal changes in the distance traveled of larvae treated with NOS inhibitors, L-NAME in three-day larvae before and after UV stimulation are shown. (G) Vertical swimming in wild-type (WT) and mutant (NOSΔ11 and NOSΔ23) larvae at two-day-old stimulated with UV (395 nm) light from side, blue (488 nm) light from top and UV (395 nm) light from top. The data are shown in 30 s bins.

**Figure 4 -- figure supplement 1** Cluster analysis of guanylate and adenylate cyclases. Connections are based on blast similarities < 1e-16 as shown on the upper right. Animal groups are colour coded as shown on the upper left. NIT-GCs, NIT domain containing guanylate cyclases; membrane-bound GCs, Membrane-bound guanylyl cyclases; sGCs, soluble guanylate cyclases; ACs, adenylate cyclases.

Figure 4 – figure supplement 1 Cluster analysis of guanylate and adenylate cyclases. Connections are based on blast similarities < 1e-16 as shown on the upper right. Animal groups are colour coded as shown on the upper left. NIT-GCs, NIT domain containing guanylate cyclases; membrane-bound GCs, Membrane-bound guanylyl cyclases; sGCs, soluble guanylate cyclases; ACs, adenylate cyclases.

**Figure 4 -- figure supplement 2** Phylogenetic tree of guanylate cyclase by maximum likelihood (ML). Guanylate cyclase-coupled receptor and soluble guanylate cyclases (sGC) as outgroups. Guanylate cyclases with NIT domains are found in most animal phyla except Porifera, Ctenophora, Urochordata and Chordata. Dot plot of Platynereis NIT-GC genes (columns) expressed in cPRC, INNOS and INRGWa (rows) using single cell RNA-Seq. The size of the dots is expressed in proportion to the percentage of cells expressing that gene relative to all cells. The colours represent the normal logarithm of the number of transcripts in the cells expressing the gene.

Figure 4 – figure supplement 2 Phylogenetic tree of guanylate cyclase by maximum likelihood (ML). Guanylate cyclase-coupled receptor and soluble guanylate cyclases (sGC) as outgroups. Guanylate cyclases with NIT domains are found in most animal phyla except Porifera, Ctenophora, Urochordata and Chordata. Dot plot of Platynereis NIT-GC genes (columns) expressed in cPRC, INNOS and INRGWa (rows) using single cell RNA-Seq. The size of the dots is expressed in proportion to the percentage of cells expressing that gene relative to all cells. The colours represent the normal logarithm of the number of transcripts in the cells expressing the gene.

**Figure 4 -- figure supplement 3** **(A)** Co-expression analysis image of the NIT-GC1 (magenta) and MLD-pedal2 amide proneuropeptide gene (MLD: green). Anterior view of the larva at two-day-old. **(B, C)** Expression analysis of the NIT-GC2 gene (magenta) using in situ HCR. Anterior (B) and posterior (C) views of the larva at three-day-old. **(D)** Co-localisation analysis using NIT-GC1 (magenta) and NOS (green) antibodies. Anterior view of the larva at two-day-old. **(E, F)** Localisation analysis using NIT-GC1 and NIT-GC2 antibodies for NIT-GC1 (E) and NIT-GC2 (F) morphant. Green shows co-staining with acetylated α-tubulin antibody (acTub). Anterior view of the larva at two-day-old.

Figure 4 – figure supplement 3 (A) Co-expression analysis image of the NIT-GC1 (magenta) and MLD-pedal2 amide proneuropeptide gene (MLD: green). Anterior view of the larva at two-day-old. (B, C) Expression analysis of the NIT-GC2 gene (magenta) using in situ HCR. Anterior (B) and posterior (C) views of the larva at three-day-old. (D) Co-localisation analysis using NIT-GC1 (magenta) and NOS (green) antibodies. Anterior view of the larva at two-day-old. (E, F) Localisation analysis using NIT-GC1 and NIT-GC2 antibodies for NIT-GC1 (E) and NIT-GC2 (F) morphant. Green shows co-staining with acetylated α-tubulin antibody (acTub). Anterior view of the larva at two-day-old.

**Figure 5 -- figure supplement 1** **(A)** Schematic diagram of the immunostaining procedure after calcium imaging.**(B-D)** Co-expression analysis image of the NOS (magenta) and RY amide proneuropeptide gene (RYa: green). Anterior view of the larva at two-day-old.

Figure 5 – figure supplement 1 (A) Schematic diagram of the immunostaining procedure after calcium imaging.(B-D) Co-expression analysis image of the NOS (magenta) and RY amide proneuropeptide gene (RYa: green). Anterior view of the larva at two-day-old.